Have questions? Visit https://www.reddit.com/r/SNPedia

rs878854272

From SNPedia

Orientationplus
Stabilizedplus
Geno Mag Summary
(CGAGGTGAGTGTATACAAAA;CGAGGTGAGTGTATACAAAA) 0 common in clinvar
Make rs878854272(-;-)
Make rs878854272(-;CGAGGTGAGTGTATACAAAA)
ReferenceGRCh38.p2 38.2/147
Chromosome2
Position202530951
GeneBMPR2
is asnp
is mentioned by
dbSNPrs878854272
dbSNP (old)rs878854272
ClinGenrs878854272
ebirs878854272
HLIrs878854272
Exacrs878854272
Varsomers878854272
Maprs878854272
PheGenIrs878854272
Biobankrs878854272
1000 genomesrs878854272
hgdprs878854272
ensemblrs878854272
gopubmedrs878854272
geneviewrs878854272
scholarrs878854272
googlers878854272
pharmgkbrs878854272
gwascentralrs878854272
openSNPrs878854272
23andMers878854272
23andMe allrs878854272
SNP Nexus

SNPshotrs878854272
SNPdbers878854272
MSV3drs878854272
GWAS Ctlgrs878854272
Max Magnitude0
ClinVar
Risk rs878854272(-;-)
Alt rs878854272(-;-)
Reference Rs878854272(CGAGGTGAGTGTATACAAAA;CGAGGTGAGTGTATACAAAA)
Significance Pathogenic
Disease Primary pulmonary hypertension
Variation info
Gene BMPR2
CLNDBN Primary pulmonary hypertension
Reversed 0
HGVS NC_000002.11:g.203395674_203395693del20
CLNSRC
CLNACC RCV000226914.1,