Have questions? Visit https://www.reddit.com/r/SNPedia

rs878854082

From SNPedia

ClinVar
Risk rs878854082(C;C)
Alt rs878854082(C;C)
Reference Rs878854082(TCTGCAGCGTGGAGATGCCTGACATCATCATCA;TCTGCAGCGTGGAGATGCCTGACATCATCATCA)
Significance Pathogenic
Disease Tuberous sclerosis 2
Variation info
Gene TSC2
CLNDBN Tuberous sclerosis 2
Reversed 0
HGVS NC_000016.9:g.2124274_2124306del33insC
CLNSRC
CLNACC RCV000231818.1,