Have questions? Visit https://www.reddit.com/r/SNPedia

rs878853252

From SNPedia

Orientationminus
Stabilizedminus
Geno Mag Summary
(-;-) 0 common in clinvar
Make rs878853252(-;CTCCCTCCTCAGCTCCTCCAGG)
Make rs878853252(CTCCCTCCTCAGCTCCTCCAGG;CTCCCTCCTCAGCTCCTCCAGG)
ReferenceGRCh38.p2 38.2/147
Chromosome1
Position8361236
GeneRERE
is asnp
is mentioned by
dbSNPrs878853252
dbSNP (old)rs878853252
ClinGenrs878853252
ebirs878853252
HLIrs878853252
Exacrs878853252
Gnomadrs878853252
Varsomers878853252
Maprs878853252
PheGenIrs878853252
Biobankrs878853252
1000 genomesrs878853252
hgdprs878853252
ensemblrs878853252
gopubmedrs878853252
geneviewrs878853252
scholarrs878853252
googlers878853252
pharmgkbrs878853252
gwascentralrs878853252
openSNPrs878853252
23andMers878853252
23andMe allrs878853252
SNP Nexus

SNPshotrs878853252
SNPdbers878853252
MSV3drs878853252
GWAS Ctlgrs878853252
Max Magnitude0
ClinVar
Risk rs878853252(CTCCCTCCTCAGCTCCTCCAGG;CTCCCTCCTCAGCTCCTCCAGG)
Alt rs878853252(CTCCCTCCTCAGCTCCTCCAGG;CTCCCTCCTCAGCTCCTCCAGG)
Reference Rs878853252(-;-)
Significance Pathogenic
Disease Neurodevelopmental disorder with or without anomalies of the brain
Variation info
Gene RERE
CLNDBN Neurodevelopmental disorder with or without anomalies of the brain, eye, or heart
Reversed 1
HGVS NC_000001.10:g.8421297_8421318dup22
CLNSRC OMIM Allelic Variant
CLNACC RCV000225146.1,