Have questions? Visit https://www.reddit.com/r/SNPedia

rs876661193

From SNPedia

ClinVar
Risk rs876661193(TGGCTTTGTGCCCCACTCTGTAACCAAGCAT;TGGCTTTGTGCCCCACTCTGTAACCAAGCAT)
Alt rs876661193(TGGCTTTGTGCCCCACTCTGTAACCAAGCAT;TGGCTTTGTGCCCCACTCTGTAACCAAGCAT)
Reference Rs876661193(-;-)
Significance Pathogenic
Disease not provided
Variation info
Gene MSH6
CLNDBN not provided
Reversed 0
HGVS NC_000002.11:g.48027476_48027477insAGCATTGGCTTTGTGCCCCACTCTGTAACCA
CLNSRC
CLNACC RCV000218334.1,