Have questions? Visit https://www.reddit.com/r/SNPedia

rs876660574

From SNPedia

Orientationminus
Stabilizedminus
Geno Mag Summary
(ATCACTGTGCAGCAGCAATCTT;ATCACTGTGCAGCAGCAATCTT) 0 common in clinvar
Make rs876660574(-;-)
Make rs876660574(-;ATCACTGTGCAGCAGCAATCTT)
ReferenceGRCh38.p2 38.2/147
Chromosome16
Position23603625
GenePALB2
is asnp
is mentioned by
dbSNPrs876660574
dbSNP (old)rs876660574
ClinGenrs876660574
ebirs876660574
HLIrs876660574
Exacrs876660574
Gnomadrs876660574
Varsomers876660574
Maprs876660574
PheGenIrs876660574
Biobankrs876660574
1000 genomesrs876660574
hgdprs876660574
ensemblrs876660574
gopubmedrs876660574
geneviewrs876660574
scholarrs876660574
googlers876660574
pharmgkbrs876660574
gwascentralrs876660574
openSNPrs876660574
23andMers876660574
23andMe allrs876660574
SNP Nexus

SNPshotrs876660574
SNPdbers876660574
MSV3drs876660574
GWAS Ctlgrs876660574
Max Magnitude0
ClinVar
Risk rs876660574(-;-)
Alt rs876660574(-;-)
Reference Rs876660574(ATCACTGTGCAGCAGCAATCTT;ATCACTGTGCAGCAGCAATCTT)
Significance Pathogenic
Disease Hereditary cancer-predisposing syndrome
Variation info
Gene PALB2
CLNDBN Hereditary cancer-predisposing syndrome
Reversed 1
HGVS NC_000016.9:g.23614946_23614967del22
CLNSRC
CLNACC RCV000214247.1,