Have questions? Visit https://www.reddit.com/r/SNPedia

rs876660077

From SNPedia

ClinVar
Risk rs876660077(-;-)
Alt rs876660077(-;-)
Reference Rs876660077(CCGGATAATCGGCAGCCGAG;CCGGATAATCGGCAGCCGAG)
Significance Pathogenic
Disease Hereditary cancer-predisposing syndrome
Variation info
Gene LOC101928103 BARD1
CLNDBN Hereditary cancer-predisposing syndrome
Reversed 1
HGVS NC_000002.11:g.215674271_215674290del20
CLNSRC
CLNACC RCV000217362.1,