Have questions? Visit https://www.reddit.com/r/SNPedia

rs876660077

From SNPedia

Orientationminus
Stabilizedminus
Geno Mag Summary
(CCGGATAATCGGCAGCCGAG;CCGGATAATCGGCAGCCGAG) 0 common in clinvar
Make rs876660077(-;-)
Make rs876660077(-;CCGGATAATCGGCAGCCGAG)
ReferenceGRCh38.p2 38.2/147
Chromosome2
Position214809547
GeneBARD1, LOC101928103
is asnp
is mentioned by
dbSNPrs876660077
dbSNP (old)rs876660077
ClinGenrs876660077
ebirs876660077
HLIrs876660077
Exacrs876660077
Gnomadrs876660077
Varsomers876660077
Maprs876660077
PheGenIrs876660077
Biobankrs876660077
1000 genomesrs876660077
hgdprs876660077
ensemblrs876660077
gopubmedrs876660077
geneviewrs876660077
scholarrs876660077
googlers876660077
pharmgkbrs876660077
gwascentralrs876660077
openSNPrs876660077
23andMers876660077
23andMe allrs876660077
SNP Nexus

SNPshotrs876660077
SNPdbers876660077
MSV3drs876660077
GWAS Ctlgrs876660077
Max Magnitude0
ClinVar
Risk rs876660077(-;-)
Alt rs876660077(-;-)
Reference Rs876660077(CCGGATAATCGGCAGCCGAG;CCGGATAATCGGCAGCCGAG)
Significance Pathogenic
Disease Hereditary cancer-predisposing syndrome
Variation info
Gene LOC101928103 BARD1
CLNDBN Hereditary cancer-predisposing syndrome
Reversed 1
HGVS NC_000002.11:g.215674271_215674290del20
CLNSRC
CLNACC RCV000217362.1,