Have questions? Visit https://www.reddit.com/r/SNPedia

rs876659260

From SNPedia

Orientationminus
Stabilizedminus
Geno Mag Summary
(ACAGTTCCTGCATGGGCGGCA;ACAGTTCCTGCATGGGCGGCA) 0 common in clinvar
Make rs876659260(-;-)
Make rs876659260(-;ACAGTTCCTGCATGGGCGGCA)
ReferenceGRCh38.p2 38.2/147
Chromosome17
Position7674227
GeneTP53
is asnp
is mentioned by
dbSNPrs876659260
dbSNP (old)rs876659260
ClinGenrs876659260
ebirs876659260
HLIrs876659260
Exacrs876659260
Gnomadrs876659260
Varsomers876659260
Maprs876659260
PheGenIrs876659260
Biobankrs876659260
1000 genomesrs876659260
hgdprs876659260
ensemblrs876659260
gopubmedrs876659260
geneviewrs876659260
scholarrs876659260
googlers876659260
pharmgkbrs876659260
gwascentralrs876659260
openSNPrs876659260
23andMers876659260
23andMe allrs876659260
SNP Nexus

SNPshotrs876659260
SNPdbers876659260
MSV3drs876659260
GWAS Ctlgrs876659260
Max Magnitude0
ClinVar
Risk rs876659260(-;-)
Alt rs876659260(-;-)
Reference Rs876659260(ACAGTTCCTGCATGGGCGGCA;ACAGTTCCTGCATGGGCGGCA)
Significance Probable-Pathogenic
Disease Hereditary cancer-predisposing syndrome
Variation info
Gene TP53
CLNDBN Hereditary cancer-predisposing syndrome
Reversed 1
HGVS NC_000017.10:g.7577545_7577565del21
CLNSRC
CLNACC RCV000222616.1,