Have questions? Visit https://www.reddit.com/r/SNPedia

rs869320627

From SNPedia

Orientationplus
Stabilizedplus
Geno Mag Summary
(-;-) 0 common in clinvar
Make rs869320627(-;CCGGTTCCGGCGGCCGGGGCTG)
Make rs869320627(CCGGTTCCGGCGGCCGGGGCTG;CCGGTTCCGGCGGCCGGGGCTG)
ReferenceGRCh38.p2 38.2/147
Chromosome20
Position18057995
GeneOVOL2
is asnp
is mentioned by
dbSNPrs869320627
dbSNP (old)rs869320627
ClinGenrs869320627
ebirs869320627
HLIrs869320627
Exacrs869320627
Gnomadrs869320627
Varsomers869320627
Maprs869320627
PheGenIrs869320627
Biobankrs869320627
1000 genomesrs869320627
hgdprs869320627
ensemblrs869320627
gopubmedrs869320627
geneviewrs869320627
scholarrs869320627
googlers869320627
pharmgkbrs869320627
gwascentralrs869320627
openSNPrs869320627
23andMers869320627
23andMe allrs869320627
SNP Nexus

SNPshotrs869320627
SNPdbers869320627
MSV3drs869320627
GWAS Ctlgrs869320627
Max Magnitude0
ClinVar
Risk rs869320627(CCGGTTCCGGCGGCCGGGGCTG;CCGGTTCCGGCGGCCGGGGCTG)
Alt rs869320627(CCGGTTCCGGCGGCCGGGGCTG;CCGGTTCCGGCGGCCGGGGCTG)
Reference Rs869320627(-;-)
Significance Pathogenic
Disease Posterior polymorphous corneal dystrophy 1
Variation info
Gene OVOL2
CLNDBN Posterior polymorphous corneal dystrophy 1
Reversed 0
HGVS NC_000020.10:g.18038618_18038639dup22
CLNSRC OMIM Allelic Variant
CLNACC RCV000210432.1,