Have questions? Visit https://www.reddit.com/r/SNPedia

rs869312771

From SNPedia

Orientationminus
Stabilizedminus
Geno Mag Summary
(CAGGGAGGAGAGCTCTGCC;CAGGGAGGAGAGCTCTGCC) 0 common in clinvar
(CAGGGAGGAGAGCTCTGCCA;CAGGGAGGAGAGCTCTGCCA) 0 common in clinvar
Make rs869312771(-;-)
Make rs869312771(-;CAGGGAGGAGAGCTCTGCC)
ReferenceGRCh38.p2 38.2/147
Chromosome1
Position45331728
GeneMUTYH
is asnp
is mentioned by
dbSNPrs869312771
dbSNP (old)rs869312771
ClinGenrs869312771
ebirs869312771
HLIrs869312771
Exacrs869312771
Gnomadrs869312771
Varsomers869312771
Maprs869312771
PheGenIrs869312771
Biobankrs869312771
1000 genomesrs869312771
hgdprs869312771
ensemblrs869312771
gopubmedrs869312771
geneviewrs869312771
scholarrs869312771
googlers869312771
pharmgkbrs869312771
gwascentralrs869312771
openSNPrs869312771
23andMers869312771
23andMe allrs869312771
SNP Nexus

SNPshotrs869312771
SNPdbers869312771
MSV3drs869312771
GWAS Ctlgrs869312771
Max Magnitude0
ClinVar
Risk rs869312771(-;-)
Alt rs869312771(-;-)
Reference Rs869312771(CAGGGAGGAGAGCTCTGCC;CAGGGAGGAGAGCTCTGCC)
Significance Pathogenic
Disease Hereditary cancer-predisposing syndrome
Variation info
Gene MUTYH
CLNDBN Hereditary cancer-predisposing syndrome
Reversed 1
HGVS NC_000001.10:g.45797400_45797418del19
CLNSRC
CLNACC RCV000210110.1,