Have questions? Visit https://www.reddit.com/r/SNPedia

rs869025656

From SNPedia

ClinVar
Risk rs869025656(-;-)
Alt rs869025656(-;-)
Reference Rs869025656(ACACTGCCAGGTACTGACGTTTTACTT;ACACTGCCAGGTACTGACGTTTTACTT)
Significance Pathogenic
Disease Von Hippel-Lindau syndrome
Variation info
Gene VHL
CLNDBN Von Hippel-Lindau syndrome
Reversed 0
HGVS NC_000003.11:g.10188311_10188337del27
CLNSRC
CLNACC RCV000208856.1,