Have questions? Visit https://www.reddit.com/r/SNPedia

rs869025629

From SNPedia

ClinVar
Risk rs869025629(-;-)
Alt rs869025629(-;-)
Reference Rs869025629(GGCACGGGCCGCCGCATCCACAGCTACCGAGGTACGGGCCCGGCGCTTAG;GGCACGGGCCGCCGCATCCACAGCTACCGAGGTACGGGCCCGGCGCTTAG)
Significance Probable-Pathogenic
Disease Von Hippel-Lindau syndrome
Variation info
Gene VHL
CLNDBN Von Hippel-Lindau syndrome
Reversed 0
HGVS NC_000003.11:g.10183842_10183891del50
CLNSRC
CLNACC RCV000208853.1,