Have questions? Visit https://www.reddit.com/r/SNPedia

rs869025282

From SNPedia

Orientationminus
Stabilizedminus
Geno Mag Summary
(-;-) 0 common in clinvar
(C;C) 0 common in clinvar
Make rs869025282(-;TTTAGGTATTTTTAGGTATT)
Make rs869025282(TTTAGGTATTTTTAGGTATT;TTTAGGTATTTTTAGGTATT)
ReferenceGRCh38.p2 38.2/147
Chromosome6
Position104771384
GeneHACE1
is asnp
is mentioned by
dbSNPrs869025282
dbSNP (old)rs869025282
ClinGenrs869025282
ebirs869025282
HLIrs869025282
Exacrs869025282
Varsomers869025282
Maprs869025282
PheGenIrs869025282
Biobankrs869025282
1000 genomesrs869025282
hgdprs869025282
ensemblrs869025282
gopubmedrs869025282
geneviewrs869025282
scholarrs869025282
googlers869025282
pharmgkbrs869025282
gwascentralrs869025282
openSNPrs869025282
23andMers869025282
23andMe allrs869025282
SNP Nexus

SNPshotrs869025282
SNPdbers869025282
MSV3drs869025282
GWAS Ctlgrs869025282
Max Magnitude0
ClinVar
Risk rs869025282(TTTAGGTATTTTTAGGTATT;TTTAGGTATTTTTAGGTATT)
Alt rs869025282(TTTAGGTATTTTTAGGTATT;TTTAGGTATTTTTAGGTATT)
Reference Rs869025282(-;-)
Significance Pathogenic
Disease Spastic paraplegia and psychomotor retardation with or without seizures
Variation info
Gene HACE1
CLNDBN Spastic paraplegia and psychomotor retardation with or without seizures
Reversed 1
HGVS NC_000006.11:g.105219259_105219260insAATACCTAAAAATACCTAAA
CLNSRC OMIM Allelic Variant
CLNACC RCV000207049.1,