Have questions? Visit https://www.reddit.com/r/SNPedia

rs864309482

From SNPedia

Orientationminus
Stabilizedminus
Geno Mag Summary
(TAGAGTGTGGGCCTCAGGAG;TAGAGTGTGGGCCTCAGGAG) 0 common in clinvar
Make rs864309482(AA;AA)
Make rs864309482(AA;TAGAGTGTGGGCCTCAGGAG)
ReferenceGRCh38.p2 38.2/147
Chromosome21
Position43774637
GeneCSTB
is asnp
is mentioned by
dbSNPrs864309482
dbSNP (old)rs864309482
ClinGenrs864309482
ebirs864309482
HLIrs864309482
Exacrs864309482
Gnomadrs864309482
Varsomers864309482
Maprs864309482
PheGenIrs864309482
Biobankrs864309482
1000 genomesrs864309482
hgdprs864309482
ensemblrs864309482
gopubmedrs864309482
geneviewrs864309482
scholarrs864309482
googlers864309482
pharmgkbrs864309482
gwascentralrs864309482
openSNPrs864309482
23andMers864309482
23andMe allrs864309482
SNP Nexus

SNPshotrs864309482
SNPdbers864309482
MSV3drs864309482
GWAS Ctlgrs864309482
Max Magnitude0
ClinVar
Risk rs864309482(AA;AA)
Alt rs864309482(AA;AA)
Reference Rs864309482(TAGAGTGTGGGCCTCAGGAG;TAGAGTGTGGGCCTCAGGAG)
Significance Pathogenic
Disease Unverricht-Lundborg syndrome
Variation info
Gene CSTB
CLNDBN Unverricht-Lundborg syndrome
Reversed 1
HGVS NC_000021.8:g.45194518_45194537del20insTT
CLNSRC
CLNACC RCV000202486.1,