Have questions? Visit https://www.reddit.com/r/SNPedia

rs863224480

From SNPedia

Orientationplus
Stabilizedplus
Geno Mag Summary
(ATAAAACCCTAGCCTTCAAA;ATAAAACCCTAGCCTTCAAA) 0 common in clinvar
Make rs863224480(-;-)
Make rs863224480(-;ATAAAACCCTAGCCTTCAAA)
ReferenceGRCh38.p2 38.2/146
Chromosome3
Position37014458
GeneMLH1
is asnp
is mentioned by
dbSNPrs863224480
dbSNP (old)rs863224480
ClinGenrs863224480
ebirs863224480
HLIrs863224480
Exacrs863224480
Gnomadrs863224480
Varsomers863224480
Maprs863224480
PheGenIrs863224480
Biobankrs863224480
1000 genomesrs863224480
hgdprs863224480
ensemblrs863224480
gopubmedrs863224480
geneviewrs863224480
scholarrs863224480
googlers863224480
pharmgkbrs863224480
gwascentralrs863224480
openSNPrs863224480
23andMers863224480
23andMe allrs863224480
SNP Nexus

SNPshotrs863224480
SNPdbers863224480
MSV3drs863224480
GWAS Ctlgrs863224480
Max Magnitude0
ClinVar
Risk rs863224480(-;-)
Alt rs863224480(-;-)
Reference Rs863224480(ATAAAACCCTAGCCTTCAAA;ATAAAACCCTAGCCTTCAAA)
Significance Pathogenic
Disease Lynch syndrome
Variation info
Gene MLH1
CLNDBN Lynch syndrome
Reversed 0
HGVS NC_000003.11:g.37055949_37055968del20
CLNSRC
CLNACC RCV000195440.1,