Have questions? Visit https://www.reddit.com/r/SNPedia

rs863223985

From SNPedia

Orientationminus
Stabilizedminus
Geno Mag Summary
(CGCAGCTGGAGGCACTGCTGT;CGCAGCTGGAGGCACTGCTGT) 0 common in clinvar
Make rs863223985(-;-)
Make rs863223985(-;CGCAGCTGGAGGCACTGCTGT)
ReferenceGRCh38.p2 38.2/146
Chromosome1
Position241506071
GeneFH
is asnp
is mentioned by
dbSNPrs863223985
dbSNP (old)rs863223985
ClinGenrs863223985
ebirs863223985
HLIrs863223985
Exacrs863223985
Gnomadrs863223985
Varsomers863223985
Maprs863223985
PheGenIrs863223985
Biobankrs863223985
1000 genomesrs863223985
hgdprs863223985
ensemblrs863223985
gopubmedrs863223985
geneviewrs863223985
scholarrs863223985
googlers863223985
pharmgkbrs863223985
gwascentralrs863223985
openSNPrs863223985
23andMers863223985
23andMe allrs863223985
SNP Nexus

SNPshotrs863223985
SNPdbers863223985
MSV3drs863223985
GWAS Ctlgrs863223985
Max Magnitude0
ClinVar
Risk rs863223985(-;-)
Alt rs863223985(-;-)
Reference Rs863223985(CGCAGCTGGAGGCACTGCTGT;CGCAGCTGGAGGCACTGCTGT)
Significance Pathogenic
Disease not provided
Variation info
Gene FH
CLNDBN not provided
Reversed 1
HGVS NC_000001.10:g.241669371_241669391del21
CLNSRC
CLNACC RCV000195479.1,