Have questions? Visit https://www.reddit.com/r/SNPedia

rs863223984

From SNPedia

ClinVar
Risk rs863223984(AATGACAAGAATAAAAGCTGC;AATGACAAGAATAAAAGCTGC)
Alt rs863223984(AATGACAAGAATAAAAGCTGC;AATGACAAGAATAAAAGCTGC)
Reference Rs863223984(;)
Significance Probable-Pathogenic
Disease not provided
Variation info
Gene FH
CLNDBN not provided
Reversed 1
HGVS NC_000001.10:g.241669413_241669433dup21
CLNSRC
CLNACC RCV000199721.1,