Have questions? Visit https://www.reddit.com/r/SNPedia

rs863223984

From SNPedia

Orientationminus
Stabilizedminus
Geno Mag Summary
(-;-) 0 common in clinvar
Make rs863223984(-;AATGACAAGAATAAAAGCTGC)
Make rs863223984(AATGACAAGAATAAAAGCTGC;AATGACAAGAATAAAAGCTGC)
ReferenceGRCh38.p2 38.2/146
Chromosome1
Position241506112
GeneFH
is asnp
is mentioned by
dbSNPrs863223984
dbSNP (old)rs863223984
ClinGenrs863223984
ebirs863223984
HLIrs863223984
Exacrs863223984
Varsomers863223984
Maprs863223984
PheGenIrs863223984
Biobankrs863223984
1000 genomesrs863223984
hgdprs863223984
ensemblrs863223984
gopubmedrs863223984
geneviewrs863223984
scholarrs863223984
googlers863223984
pharmgkbrs863223984
gwascentralrs863223984
openSNPrs863223984
23andMers863223984
23andMe allrs863223984
SNP Nexus

SNPshotrs863223984
SNPdbers863223984
MSV3drs863223984
GWAS Ctlgrs863223984
Max Magnitude0
ClinVar
Risk rs863223984(AATGACAAGAATAAAAGCTGC;AATGACAAGAATAAAAGCTGC)
Alt rs863223984(AATGACAAGAATAAAAGCTGC;AATGACAAGAATAAAAGCTGC)
Reference Rs863223984(-;-)
Significance Probable-Pathogenic
Disease not provided
Variation info
Gene FH
CLNDBN not provided
Reversed 1
HGVS NC_000001.10:g.241669413_241669433dup21
CLNSRC
CLNACC RCV000199721.1,