Have questions? Visit https://www.reddit.com/r/SNPedia

rs863223661(GCAGCGATGCGTTCCCCACGGACGCGCGGC;GCAGCGATGCGTTCCCCACGGACGCGCGGC)

From SNPedia

common in clinvar
Is agenotype
ofrs863223661
Gene
Chromosome20
Position10,673,507
mentionedby
Magnitude0
ReputeGood
Geno Mag Summary
(GCAGCGATGCGTTCCCCACGGACGCGCGGC;GCAGCGATGCGTTCCCCACGGACGCGCGGC) 0 common in clinvar