Have questions? Visit https://www.reddit.com/r/SNPedia

rs863223422

From SNPedia

ClinVar
Risk rs863223422(-;-)
Alt rs863223422(-;-)
Reference Rs863223422(CTCAAGGAGACAATCGAAGACTGTT;CTCAAGGAGACAATCGAAGACTGTT)
Significance Pathogenic
Disease Primary pulmonary hypertension
Variation info
Gene BMPR2
CLNDBN Primary pulmonary hypertension
Reversed 0
HGVS NC_000002.11:g.203417451_203417475del25
CLNSRC
CLNACC RCV000488818.1,