Have questions? Visit https://www.reddit.com/r/SNPedia

rs863223280

From SNPedia

ClinVar
Risk rs863223280(AGGTGGGCACAGGGGTGCGC;AGGTGGGCACAGGGGTGCGC)
Alt rs863223280(AGGTGGGCACAGGGGTGCGC;AGGTGGGCACAGGGGTGCGC)
Reference Rs863223280(;)
Significance Pathogenic
Disease Heterotaxy
Variation info
Gene CFC1
CLNDBN Heterotaxy, visceral, 2, autosomal
Reversed 1
HGVS NC_000002.11:g.131355424_131355443dup20
CLNSRC OMIM Allelic Variant
CLNACC RCV000005500.3,