Have questions? Visit https://www.reddit.com/r/SNPedia

rs863223280

From SNPedia

Orientationminus
Stabilizedminus
Geno Mag Summary
(-;-) 0 common in clinvar
Make rs863223280(-;CAGGTGGGCACAGGGGTGCG)
Make rs863223280(CAGGTGGGCACAGGGGTGCG;CAGGTGGGCACAGGGGTGCG)
ReferenceGRCh38.p2 38.2/146
Chromosome2
Position130597850
GeneCFC1, POTEI
is asnp
is mentioned by
dbSNPrs863223280
dbSNP (old)rs863223280
ClinGenrs863223280
ebirs863223280
HLIrs863223280
Exacrs863223280
Varsomers863223280
Maprs863223280
PheGenIrs863223280
Biobankrs863223280
1000 genomesrs863223280
hgdprs863223280
ensemblrs863223280
gopubmedrs863223280
geneviewrs863223280
scholarrs863223280
googlers863223280
pharmgkbrs863223280
gwascentralrs863223280
openSNPrs863223280
23andMers863223280
23andMe allrs863223280
SNP Nexus

SNPshotrs863223280
SNPdbers863223280
MSV3drs863223280
GWAS Ctlgrs863223280
Max Magnitude0
ClinVar
Risk rs863223280(AGGTGGGCACAGGGGTGCGC;AGGTGGGCACAGGGGTGCGC)
Alt rs863223280(AGGTGGGCACAGGGGTGCGC;AGGTGGGCACAGGGGTGCGC)
Reference Rs863223280(-;-)
Significance Pathogenic
Disease Heterotaxy
Variation info
Gene CFC1
CLNDBN Heterotaxy, visceral, 2, autosomal
Reversed 1
HGVS NC_000002.11:g.131355424_131355443dup20
CLNSRC OMIM Allelic Variant
CLNACC RCV000005500.3,