Have questions? Visit https://www.reddit.com/r/SNPedia

rs80359883

From SNPedia

Orientationminus
Stabilizedminus
Geno Mag Summary
(-;CGAGAGTGGGTGTTGGACAGTGTAGCACTCTACCAGTGCCAGGAGCTGGACACCTACCTGAT) 6 BRCA1 variant considered pathogenic for breast cancer
(CGAGAGTGGGTGTTGGACAGTGTAGCACTCTACCAGTGCCAGGAGCTGGACACCTACCTGAT;CGAGAGTGGGTGTTGGACAGTGTAGCACTCTACCAGTGCCAGGAGCTGGACACCTACCTGAT) 0 common in clinvar


Make rs80359883(-;-)
ReferenceGRCh38 38.1/141
Chromosome17
Position43045706
GeneBRCA1
is asnp
is mentioned by
dbSNPrs80359883
dbSNP (old)rs80359883
ClinGenrs80359883
ebirs80359883
HLIrs80359883
Exacrs80359883
Varsomers80359883
Maprs80359883
PheGenIrs80359883
Biobankrs80359883
1000 genomesrs80359883
hgdprs80359883
ensemblrs80359883
gopubmedrs80359883
geneviewrs80359883
scholarrs80359883
googlers80359883
pharmgkbrs80359883
gwascentralrs80359883
openSNPrs80359883
23andMers80359883
23andMe allrs80359883
SNP Nexus

SNPshotrs80359883
SNPdbers80359883
MSV3drs80359883
GWAS Ctlgrs80359883
Max Magnitude6

BRCA1, c.5503_5564del62 (p.Arg1835Thrfs)

ClinVar
Risk rs80359883(-;-)
Alt rs80359883(-;-)
Reference Rs80359883(CGAGAGTGGGTGTTGGACAGTGTAGCACTCTACCAGTGCCAGGAGCTGGACACCTACCTGAT;CGAGAGTGGGTGTTGGACAGTGTAGCACTCTACCAGTGCCAGGAGCTGGACACCTACCTGAT)
Significance Pathogenic
Disease Familial cancer of breast Breast-ovarian cancer
Variation info
Gene BRCA1
CLNDBN Familial cancer of breast Breast-ovarian cancer, familial 1
Reversed 1
HGVS NC_000017.10:g.41197723_41197784del62
CLNSRC Breast Cancer Information Core (BRCA1)
CLNACC RCV000049021.2, RCV000112684.3,