Have questions? Visit https://www.reddit.com/r/SNPedia

rs80359875

From SNPedia

Orientationminus
Stabilizedminus
Geno Mag Summary
(-;GAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA) 6 BRCA1 variant considered pathogenic for breast cancer
(GAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA;GAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA) 0 common in clinvar


Make rs80359875(-;-)
ReferenceGRCh38 38.1/141
Chromosome17
Position43094390
GeneBRCA1
is asnp
is mentioned by
dbSNPrs80359875
dbSNP (old)rs80359875
ClinGenrs80359875
ebirs80359875
HLIrs80359875
Exacrs80359875
Gnomadrs80359875
Varsomers80359875
Maprs80359875
PheGenIrs80359875
Biobankrs80359875
1000 genomesrs80359875
hgdprs80359875
ensemblrs80359875
gopubmedrs80359875
geneviewrs80359875
scholarrs80359875
googlers80359875
pharmgkbrs80359875
gwascentralrs80359875
openSNPrs80359875
23andMers80359875
23andMe allrs80359875
SNP Nexus

SNPshotrs80359875
SNPdbers80359875
MSV3drs80359875
GWAS Ctlgrs80359875
Max Magnitude6
rs80359875, also known as 1205del56, c.1086_1141del and p.Glu362_Lys381?fs, is a variant in the BRCA1 gene considered pathogenic for breast cancer in ClinVar.
ClinVar
Risk rs80359875(-;-)
Alt rs80359875(-;-)
Reference Rs80359875(GAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA;GAATCCTAGAGATACTGAAGATGTTCCTTGGATAACACTAAATAGCAGCATTCAGA)
Significance Pathogenic
Disease Breast-ovarian cancer Hereditary breast and ovarian cancer syndrome
Variation info
Gene BRCA1
CLNDBN Breast-ovarian cancer, familial 1 Hereditary breast and ovarian cancer syndrome
Reversed 1
HGVS NC_000017.10:g.41246407_41246462del56
CLNSRC Breast Cancer Information Core (BRCA1)
CLNACC RCV000077056.5, RCV000465634.1,