Have questions? Visit https://www.reddit.com/r/SNPedia


From SNPedia

Geno Mag Summary
(-;CGCGTTGAAGAAGTACAAAATGTCATTAA) 6 BRCA1 variant considered pathogenic for breast cancer

Make rs80359871(-;-)
ReferenceGRCh38 38.1/142
is asnp
is mentioned by
1000 genomesrs80359871
23andMe allrs80359871
SNP Nexus

GWAS Ctlgrs80359871
Max Magnitude6
rs80359871, also known as 138del29, c.19_47del and p.Arg7_Asn16?fs, is a variant in the BRCA1 gene considered pathogenic for breast cancer in ClinVar.
Risk rs80359871(-;-)
Alt rs80359871(-;-)
Significance Pathogenic
Disease Breast-ovarian cancer Hereditary cancer-predisposing syndrome
Variation info
CLNDBN Breast-ovarian cancer, familial 1 Hereditary cancer-predisposing syndrome
Reversed 1
HGVS NC_000017.10:g.41276067_41276095del29
CLNSRC Breast Cancer Information Core (BRCA1)
CLNACC RCV000111579.3, RCV000163512.1,