Have questions? Visit https://www.reddit.com/r/SNPedia

rs80359736

From SNPedia

ClinVar
Risk
Alt
Reference
The wikipage input value "rs80359736(TCCATCATCAGATTTATATTCTCTGTTAACAGAAGGAAAGAGATACAGAATTTATCATCTTGCAACTTCAAAATCTAAAAGTAAATCTGAAAGAGCTAACATACAGTTAGCAGCGACAAAAAAAAC;TCCATCATCAGATTTATATTCTCTGTTAACAGAAGGAAAGAGATACAGAATTTATCATCTTGCAACTTCAAAATCTAAAAGTAAATCTGAAAGAGCTAACATACAGTTAGCAGCGACAAAAAAAAC)" contains invalid characters or is incomplete and therefore can cause unexpected results during a query or annotation process.
rs80359736(TCCATCATCAGATTTATATTCTCTGTTAACAGAAGGAAAGAGATACAGAATTTATCATCTTGCAACTTCAAAATCTAAAAGTAAATCTGAAAGAGCTAACATACAGTTAGCAGCGACAAAAAAAAC;TCCATCATCAGATTTATATTCTCTGTTAACAGAAGGAAAGAGATACAGAATTTATCATCTTGCAACTTCAAAATCTAAAAGTAAATCTGAAAGAGCTAACATACAGTTAGCAGCGACAAAAAAAAC)
Significance Other
Disease Breast-ovarian cancer
Variation info
Gene BRCA2
CLNDBN Breast-ovarian cancer, familial 2
Reversed 0
HGVS NC_000013.10:g.32953908_32954033del126
CLNSRC Breast Cancer Information Core (BRCA2)
CLNACC RCV000082997.4,