Have questions? Visit https://www.reddit.com/r/SNPedia


From SNPedia

Geno Mag Summary
(-;GGCTATAAAAAAGATAATGGAAA) 6 BRCA2 variant considered pathogenic for breast cancer

Make rs80359690(-;-)
ReferenceGRCh38 38.1/142
is asnp
is mentioned by
dbSNP (old)rs80359690
1000 genomesrs80359690
23andMe allrs80359690
SNP Nexus

GWAS Ctlgrs80359690
Merged fromRs886038181
Max Magnitude6
rs80359690, also known as 8238del23, c.8010_8032del and p.Ser2670_Arg2678?fs, is a variant in the BRCA2 gene considered pathogenic for breast cancer in ClinVar.
Significance Pathogenic
Disease Breast-ovarian cancer
Variation info
Gene BRCA2
CLNDBN Breast-ovarian cancer, familial 2
Reversed 0
HGVS NC_000013.10:g.32937351_32937373del23
CLNSRC Breast Cancer Information Core (BRCA2)
CLNACC RCV000241352.2,