Have questions? Visit https://www.reddit.com/r/SNPedia


From SNPedia
(Redirected from Rs80338725(;))

common in clinvar
Is agenotype
Geno Mag Summary
(-;-) 0 common in clinvar
(-;GAGATTACAGGTGGCTGCCCGGG) 3 Carrier of a citrullinemia/citrin deficiency allele
(GAGATTACAGGTGGCTGCCCGGG;GAGATTACAGGTGGCTGCCCGGG) 5.7 Citrullinemia type II/citrin deficiency; neonatal and/or adult-onset
(GCT;GCT) 0 common in clinvar