Have questions? Visit https://www.reddit.com/r/SNPedia

rs797045954

From SNPedia

Orientationminus
Stabilizedminus
Geno Mag Summary
(ACCAGTTCCCCCTCGAGGCC;ACCAGTTCCCCCTCGAGGCC) 0 common in clinvar
Make rs797045954(-;-)
Make rs797045954(-;ACCAGTTCCCCCTCGAGGCC)
ReferenceGRCh38.p2 38.2/146
Chromosome1
Position149923568
GeneSF3B4
is asnp
is mentioned by
dbSNPrs797045954
dbSNP (old)rs797045954
ClinGenrs797045954
ebirs797045954
HLIrs797045954
Exacrs797045954
Gnomadrs797045954
Varsomers797045954
Maprs797045954
PheGenIrs797045954
Biobankrs797045954
1000 genomesrs797045954
hgdprs797045954
ensemblrs797045954
gopubmedrs797045954
geneviewrs797045954
scholarrs797045954
googlers797045954
pharmgkbrs797045954
gwascentralrs797045954
openSNPrs797045954
23andMers797045954
23andMe allrs797045954
SNP Nexus

SNPshotrs797045954
SNPdbers797045954
MSV3drs797045954
GWAS Ctlgrs797045954
Max Magnitude0
ClinVar
Risk rs797045954(-;-)
Alt rs797045954(-;-)
Reference Rs797045954(ACCAGTTCCCCCTCGAGGCC;ACCAGTTCCCCCTCGAGGCC)
Significance Pathogenic
Disease Nager syndrome
Variation info
Gene SF3B4
CLNDBN Nager syndrome
Reversed 1
HGVS NC_000001.10:g.149895460_149895479del20
CLNSRC
CLNACC RCV000192855.1,