Have questions? Visit https://www.reddit.com/r/SNPedia

rs797045212

From SNPedia

Orientationminus
Stabilizedminus
Geno Mag Summary
(-;-) 0 common in clinvar
Make rs797045212(-;GAGGCCACGGCTTCCATTGAC)
Make rs797045212(GAGGCCACGGCTTCCATTGAC;GAGGCCACGGCTTCCATTGAC)
ReferenceGRCh38.p2 38.2/146
Chromosome11
Position17394274
GeneABCC8
is asnp
is mentioned by
dbSNPrs797045212
dbSNP (old)rs797045212
ClinGenrs797045212
ebirs797045212
HLIrs797045212
Exacrs797045212
Gnomadrs797045212
Varsomers797045212
Maprs797045212
PheGenIrs797045212
Biobankrs797045212
1000 genomesrs797045212
hgdprs797045212
ensemblrs797045212
gopubmedrs797045212
geneviewrs797045212
scholarrs797045212
googlers797045212
pharmgkbrs797045212
gwascentralrs797045212
openSNPrs797045212
23andMers797045212
23andMe allrs797045212
SNP Nexus

SNPshotrs797045212
SNPdbers797045212
MSV3drs797045212
GWAS Ctlgrs797045212
Max Magnitude0
ClinVar
Risk rs797045212(GAGGCCACGGCTTCCATTGAC;GAGGCCACGGCTTCCATTGAC)
Alt rs797045212(GAGGCCACGGCTTCCATTGAC;GAGGCCACGGCTTCCATTGAC)
Reference Rs797045212(-;-)
Significance Probable-Pathogenic
Disease Persistent hyperinsulinemic hypoglycemia of infancy
Variation info
Gene ABCC8
CLNDBN Persistent hyperinsulinemic hypoglycemia of infancy
Reversed 1
HGVS NC_000011.9:g.17415822_17415842dup21
CLNSRC
CLNACC RCV000193129.1,