Have questions? Visit https://www.reddit.com/r/SNPedia

rs797045212

From SNPedia

ClinVar
Risk rs797045212(GAGGCCACGGCTTCCATTGAC;GAGGCCACGGCTTCCATTGAC)
Alt rs797045212(GAGGCCACGGCTTCCATTGAC;GAGGCCACGGCTTCCATTGAC)
Reference Rs797045212(;)
Significance Probable-Pathogenic
Disease Persistent hyperinsulinemic hypoglycemia of infancy
Variation info
Gene ABCC8
CLNDBN Persistent hyperinsulinemic hypoglycemia of infancy
Reversed 1
HGVS NC_000011.9:g.17415822_17415842dup21
CLNSRC
CLNACC RCV000193129.1,