Have questions? Visit https://www.reddit.com/r/SNPedia

rs796051932(-;-)

From SNPedia
(Redirected from Rs796051932(C;C))

common in clinvar
Is agenotype
ofrs796051932
GeneASL
Chromosome7
Position66,086,776
mentionedby
Magnitude0
ReputeGood
Geno Mag Summary
(-;-) 0 common in clinvar
(-;TGGCACTGACCCGAGACTCTGAGCG) 3 Unaffected carrier of one bad argininosuccinate lyase allele
(TGGCACTGACCCGAGACTCTGAGCG;TGGCACTGACCCGAGACTCTGAGCG) 8 Argininosuccinate lyase deficiency