Have questions? Visit https://www.reddit.com/r/SNPedia

rs794729357

From SNPedia

Orientationminus
Stabilizedminus
Geno Mag Summary
(CC;CC) 0 common in clinvar
Make rs794729357(CC;TGTTATTAGTGATATATCTAA)
Make rs794729357(TGTTATTAGTGATATATCTAA;TGTTATTAGTGATATATCTAA)
ReferenceGRCh38.p2 38.2/146
Chromosome2
Position178557935
GeneTTN, TTN-AS1
is asnp
is mentioned by
dbSNPrs794729357
dbSNP (old)rs794729357
ClinGenrs794729357
ebirs794729357
HLIrs794729357
Exacrs794729357
Gnomadrs794729357
Varsomers794729357
Maprs794729357
PheGenIrs794729357
Biobankrs794729357
1000 genomesrs794729357
hgdprs794729357
ensemblrs794729357
gopubmedrs794729357
geneviewrs794729357
scholarrs794729357
googlers794729357
pharmgkbrs794729357
gwascentralrs794729357
openSNPrs794729357
23andMers794729357
23andMe allrs794729357
SNP Nexus

SNPshotrs794729357
SNPdbers794729357
MSV3drs794729357
GWAS Ctlgrs794729357
Max Magnitude0
ClinVar
Risk rs794729357(TGTTATTAGTGATATATCTAA;TGTTATTAGTGATATATCTAA)
Alt rs794729357(TGTTATTAGTGATATATCTAA;TGTTATTAGTGATATATCTAA)
Reference Rs794729357(CC;CC)
Significance Pathogenic
Disease not provided
Variation info
Gene TTN TTN-AS1
CLNDBN not provided
Reversed 1
HGVS NC_000002.11:g.179422662_179422663delGGinsTTAGATATATCACTAATAACA
CLNSRC
CLNACC RCV000184350.2,