Have questions? Visit https://www.reddit.com/r/SNPedia

rs794728951

From SNPedia

Orientationminus
Stabilizedminus
Geno Mag Summary
(-;-) 0 common in clinvar
Make rs794728951(-;CTCTCCTTGAGGCGCCGGTTGCC)
Make rs794728951(CTCTCCTTGAGGCGCCGGTTGCC;CTCTCCTTGAGGCGCCGGTTGCC)
ReferenceGRCh38.p2 38.2/146
Chromosome1
Position17053978
GeneSDHB
is asnp
is mentioned by
dbSNPrs794728951
dbSNP (old)rs794728951
ClinGenrs794728951
ebirs794728951
HLIrs794728951
Exacrs794728951
Gnomadrs794728951
Varsomers794728951
Maprs794728951
PheGenIrs794728951
Biobankrs794728951
1000 genomesrs794728951
hgdprs794728951
ensemblrs794728951
gopubmedrs794728951
geneviewrs794728951
scholarrs794728951
googlers794728951
pharmgkbrs794728951
gwascentralrs794728951
openSNPrs794728951
23andMers794728951
23andMe allrs794728951
SNP Nexus

SNPshotrs794728951
SNPdbers794728951
MSV3drs794728951
GWAS Ctlgrs794728951
Max Magnitude0
ClinVar
Risk rs794728951(CTCTCCTTGAGGCGCCGGTTGCC;CTCTCCTTGAGGCGCCGGTTGCC)
Alt rs794728951(CTCTCCTTGAGGCGCCGGTTGCC;CTCTCCTTGAGGCGCCGGTTGCC)
Reference Rs794728951(;)
Significance Pathogenic
Disease not provided
Variation info
Gene SDHB
CLNDBN not provided
Reversed 1
HGVS NC_000001.10:g.17380474_17380496dup23
CLNSRC
CLNACC RCV000183222.1,