Have questions? Visit https://www.reddit.com/r/SNPedia

rs794727644

From SNPedia

Orientationminus
Stabilizedminus
Geno Mag Summary
(ATGGGCACCCTGATCTCGGAGC;ATGGGCACCCTGATCTCGGAGC) 0 common in clinvar
Make rs794727644(-;-)
Make rs794727644(-;ATGGGCACCCTGATCTCGGAGC)
ReferenceGRCh38.p2 38.2/146
Chromosome6
Position43051282
GeneCUL7
is asnp
is mentioned by
dbSNPrs794727644
dbSNP (old)rs794727644
ClinGenrs794727644
ebirs794727644
HLIrs794727644
Exacrs794727644
Gnomadrs794727644
Varsomers794727644
Maprs794727644
PheGenIrs794727644
Biobankrs794727644
1000 genomesrs794727644
hgdprs794727644
ensemblrs794727644
gopubmedrs794727644
geneviewrs794727644
scholarrs794727644
googlers794727644
pharmgkbrs794727644
gwascentralrs794727644
openSNPrs794727644
23andMers794727644
23andMe allrs794727644
SNP Nexus

SNPshotrs794727644
SNPdbers794727644
MSV3drs794727644
GWAS Ctlgrs794727644
Max Magnitude0
ClinVar
Risk rs794727644(-;-)
Alt rs794727644(-;-)
Reference Rs794727644(ATGGGCACCCTGATCTCGGAGC;ATGGGCACCCTGATCTCGGAGC)
Significance Pathogenic
Disease Three M syndrome 1
Variation info
Gene CUL7
CLNDBN Three M syndrome 1
Reversed 1
HGVS NC_000006.11:g.43019020_43019041delGCTCCGAGATCAGGGTGCCCAT
CLNSRC
CLNACC RCV000178294.1,