Have questions? Visit https://www.reddit.com/r/SNPedia

rs786205244

From SNPedia

Orientationminus
Stabilizedminus
Geno Mag Summary
(CTCCCGGCCCTGCACATCGC;CTCCCGGCCCTGCACATCGC) 0 common in clinvar
Make rs786205244(-;-)
Make rs786205244(-;CTCCCGGCCCTGCACATCGC)
ReferenceGRCh38.p2 38.2/146
Chromosome8
Position41725834
GeneANK1
is asnp
is mentioned by
dbSNPrs786205244
dbSNP (old)rs786205244
ClinGenrs786205244
ebirs786205244
HLIrs786205244
Exacrs786205244
Gnomadrs786205244
Varsomers786205244
Maprs786205244
PheGenIrs786205244
Biobankrs786205244
1000 genomesrs786205244
hgdprs786205244
ensemblrs786205244
gopubmedrs786205244
geneviewrs786205244
scholarrs786205244
googlers786205244
pharmgkbrs786205244
gwascentralrs786205244
openSNPrs786205244
23andMers786205244
23andMe allrs786205244
SNP Nexus

SNPshotrs786205244
SNPdbers786205244
MSV3drs786205244
GWAS Ctlgrs786205244
Max Magnitude0
ClinVar
Risk rs786205244(-;-)
Alt rs786205244(-;-)
Reference Rs786205244(CTCCCGGCCCTGCACATCGC;CTCCCGGCCCTGCACATCGC)
Significance Pathogenic
Disease Spherocytosis
Variation info
Gene ANK1
CLNDBN Spherocytosis, type 1, autosomal recessive
Reversed 1
HGVS NC_000008.10:g.41583352_41583371del20
CLNSRC OMIM Allelic Variant
CLNACC RCV000000543.4,