Have questions? Visit https://www.reddit.com/r/SNPedia

rs786205082

From SNPedia

ClinVar
Risk rs786205082(ACTCCCACAGACCTACTGTGTGT;ACTCCCACAGACCTACTGTGTGT)
Alt rs786205082(ACTCCCACAGACCTACTGTGTGT;ACTCCCACAGACCTACTGTGTGT)
Reference Rs786205082(;)
Significance Pathogenic
Disease Limb-girdle muscular dystrophy
Variation info
Gene DYSF
CLNDBN Limb-girdle muscular dystrophy, type 2B
Reversed 0
HGVS NC_000002.11:g.71891550_71891572dup23
CLNSRC OMIM Allelic Variant
CLNACC RCV000007054.3,