Have questions? Visit https://www.reddit.com/r/SNPedia

rs786205082

From SNPedia

Orientationplus
Stabilizedplus
Geno Mag Summary
(-;-) 0 common in clinvar
Make rs786205082(-;TCCCACAGACCTACTGTGTGTAC)
Make rs786205082(TCCCACAGACCTACTGTGTGTAC;TCCCACAGACCTACTGTGTGTAC)
ReferenceGRCh38.p2 38.2/146
Chromosome2
Position71664442
GeneDYSF
is asnp
is mentioned by
dbSNPrs786205082
dbSNP (old)rs786205082
ClinGenrs786205082
ebirs786205082
HLIrs786205082
Exacrs786205082
Varsomers786205082
Maprs786205082
PheGenIrs786205082
Biobankrs786205082
1000 genomesrs786205082
hgdprs786205082
ensemblrs786205082
gopubmedrs786205082
geneviewrs786205082
scholarrs786205082
googlers786205082
pharmgkbrs786205082
gwascentralrs786205082
openSNPrs786205082
23andMers786205082
23andMe allrs786205082
SNP Nexus

SNPshotrs786205082
SNPdbers786205082
MSV3drs786205082
GWAS Ctlgrs786205082
Max Magnitude0
ClinVar
Risk rs786205082(ACTCCCACAGACCTACTGTGTGT;ACTCCCACAGACCTACTGTGTGT)
Alt rs786205082(ACTCCCACAGACCTACTGTGTGT;ACTCCCACAGACCTACTGTGTGT)
Reference Rs786205082(-;-)
Significance Pathogenic
Disease Limb-girdle muscular dystrophy
Variation info
Gene DYSF
CLNDBN Limb-girdle muscular dystrophy, type 2B
Reversed 0
HGVS NC_000002.11:g.71891550_71891572dup23
CLNSRC OMIM Allelic Variant
CLNACC RCV000007054.3,