Have questions? Visit https://www.reddit.com/r/SNPedia

rs786205062(-;-)

From SNPedia
(Redirected from Rs786205062(C;C))

Combined partial 17-alpha-hydroxylase/17,20-lyase deficiency
Is agenotype
ofrs786205062
GeneCYP17A1
Chromosome10
Position102,837,132
mentionedby
Magnitude6.3
ReputeBad
Geno Mag Summary
(-;-) 6.3 Combined partial 17-alpha-hydroxylase/17,20-lyase deficiency
(-;GCACCAAGACTACAGTGATTGTCGG) 3 Carrier of a partial 17-alpha-hydroxylase/17,20-lyase deficiency mutation
(GCACCAAGACTACAGTGATTGTCGG;GCACCAAGACTACAGTGATTGTCGG) 0 common in clinvar

see ClinVar box on SNP page for citation links