Have questions? Visit https://www.reddit.com/r/SNPedia

rs786205019

From SNPedia

ClinVar
Risk rs786205019(CTGAGCCCCAGGACTTGAGCA;CTGAGCCCCAGGACTTGAGCA)
Alt rs786205019(CTGAGCCCCAGGACTTGAGCA;CTGAGCCCCAGGACTTGAGCA)
Reference Rs786205019(ACCTCCACCTGAGCCCGAGAG;ACCTCCACCTGAGCCCGAGAG)
Significance Pathogenic
Disease Attention deficit hyperactivity disorder Rett syndrome
Variation info
Gene MECP2
CLNDBN Attention deficit hyperactivity disorder Rett syndrome
Reversed 1
HGVS NC_000023.10:g.153296095_153296115del21insTGCTCAAGTCCTGGGGCTCAG
CLNSRC
CLNACC RCV000170149.1, RCV000170150.1,