Have questions? Visit https://www.reddit.com/r/SNPedia

rs786204785

From SNPedia

Orientationminus
Stabilizedminus
Geno Mag Summary
(-;-) 0 common in clinvar
Make rs786204785(-;GAGAAGCGGCGGCAGATCAG)
Make rs786204785(GAGAAGCGGCGGCAGATCAG;GAGAAGCGGCGGCAGATCAG)
ReferenceGRCh38.p2 38.2/146
Chromosome14
Position50944359
GeneLOC105370492, PYGL
is asnp
is mentioned by
dbSNPrs786204785
dbSNP (old)rs786204785
ClinGenrs786204785
ebirs786204785
HLIrs786204785
Exacrs786204785
Varsomers786204785
Maprs786204785
PheGenIrs786204785
Biobankrs786204785
1000 genomesrs786204785
hgdprs786204785
ensemblrs786204785
gopubmedrs786204785
geneviewrs786204785
scholarrs786204785
googlers786204785
pharmgkbrs786204785
gwascentralrs786204785
openSNPrs786204785
23andMers786204785
23andMe allrs786204785
SNP Nexus

SNPshotrs786204785
SNPdbers786204785
MSV3drs786204785
GWAS Ctlgrs786204785
Max Magnitude0
ClinVar
Risk rs786204785(GAGAAGCGGCGGCAGATCAG;GAGAAGCGGCGGCAGATCAG)
Alt rs786204785(GAGAAGCGGCGGCAGATCAG;GAGAAGCGGCGGCAGATCAG)
Reference Rs786204785(-;-)
Significance Pathogenic
Disease Glycogen storage disease
Variation info
Gene PYGL
CLNDBN Glycogen storage disease, type VI
Reversed 1
HGVS NC_000014.8:g.51411077_51411078insCTGATCTGCCGCCGCTTCTC
CLNSRC
CLNACC RCV000169673.1,