Have questions? Visit https://www.reddit.com/r/SNPedia

rs786204532

From SNPedia

Orientationplus
Stabilizedplus
Geno Mag Summary
(TATATCACAGGCCTCGCCGA;TATATCACAGGCCTCGCCGA) 0 common in clinvar
Make rs786204532(C;C)
Make rs786204532(C;TATATCACAGGCCTCGCCGA)
ReferenceGRCh38.p2 38.2/146
Chromosome17
Position80107630
GeneGAA
is asnp
is mentioned by
dbSNPrs786204532
dbSNP (old)rs786204532
ClinGenrs786204532
ebirs786204532
HLIrs786204532
Exacrs786204532
Gnomadrs786204532
Varsomers786204532
Maprs786204532
PheGenIrs786204532
Biobankrs786204532
1000 genomesrs786204532
hgdprs786204532
ensemblrs786204532
gopubmedrs786204532
geneviewrs786204532
scholarrs786204532
googlers786204532
pharmgkbrs786204532
gwascentralrs786204532
openSNPrs786204532
23andMers786204532
23andMe allrs786204532
SNP Nexus

SNPshotrs786204532
SNPdbers786204532
MSV3drs786204532
GWAS Ctlgrs786204532
Max Magnitude0
ClinVar
Risk rs786204532(C;C)
Alt rs786204532(C;C)
Reference Rs786204532(TATATCACAGGCCTCGCCGA;TATATCACAGGCCTCGCCGA)
Significance Other
Disease Glycogen storage disease
Variation info
Gene GAA
CLNDBN Glycogen storage disease, type II
Reversed 0
HGVS NC_000017.10:g.78081429_78081448del20insC
CLNSRC Counsyl
CLNACC RCV000169234.2,