Have questions? Visit https://www.reddit.com/r/SNPedia

rs786204329

From SNPedia

ClinVar
Risk rs786204329(ATCACCGATGCCCAGCCTGCCTTCAC;ATCACCGATGCCCAGCCTGCCTTCAC)
Alt rs786204329(ATCACCGATGCCCAGCCTGCCTTCAC;ATCACCGATGCCCAGCCTGCCTTCAC)
Reference Rs786204329(-;-)
Significance Pathogenic
Disease Familial hypertrophic cardiomyopathy 4 Primary familial hypertrophic cardiomyopathy
Variation info
Gene MYBPC3
CLNDBN Familial hypertrophic cardiomyopathy 4 Primary familial hypertrophic cardiomyopathy
Reversed 1
HGVS NC_000011.9:g.47370046_47370071dup26
CLNSRC Children's Hospital of Eastern Ontario
CLNACC RCV000168752.3, RCV000257926.2,