Have questions? Visit https://www.reddit.com/r/SNPedia

rs786202415

From SNPedia

Orientationminus
Stabilizedminus
Geno Mag Summary
(AACAGAAGTTCAGCTTCGGTTT;AACAGAAGTTCAGCTTCGGTTT) 0 common in clinvar
Make rs786202415(-;-)
Make rs786202415(-;AACAGAAGTTCAGCTTCGGTTT)
ReferenceGRCh38.p2 38.2/146
Chromosome17
Position61799189
GeneBRIP1
is asnp
is mentioned by
dbSNPrs786202415
dbSNP (old)rs786202415
ClinGenrs786202415
ebirs786202415
HLIrs786202415
Exacrs786202415
Gnomadrs786202415
Varsomers786202415
Maprs786202415
PheGenIrs786202415
Biobankrs786202415
1000 genomesrs786202415
hgdprs786202415
ensemblrs786202415
gopubmedrs786202415
geneviewrs786202415
scholarrs786202415
googlers786202415
pharmgkbrs786202415
gwascentralrs786202415
openSNPrs786202415
23andMers786202415
23andMe allrs786202415
SNP Nexus

SNPshotrs786202415
SNPdbers786202415
MSV3drs786202415
GWAS Ctlgrs786202415
Max Magnitude0
ClinVar
Risk rs786202415(-;-)
Alt rs786202415(-;-)
Reference Rs786202415(AACAGAAGTTCAGCTTCGGTTT;AACAGAAGTTCAGCTTCGGTTT)
Significance Pathogenic
Disease Hereditary cancer-predisposing syndrome
Variation info
Gene BRIP1
CLNDBN Hereditary cancer-predisposing syndrome
Reversed 1
HGVS NC_000017.10:g.59876550_59876571del22
CLNSRC
CLNACC RCV000165215.1,