Have questions? Visit https://www.reddit.com/r/SNPedia

rs771084683

From SNPedia

ClinVar
Risk rs771084683(CATTACTG;CATTACTG) rs771084683(GCCTGTTCACAATGAGCTTGCATTCCAGCCTCCCATTTCCAA;GCCTGTTCACAATGAGCTTGCATTCCAGCCTCCCATTTCCAA) rs771084683(GCCTGTTCACAATGAGCTTGCATTCCAGCCTCCCATTTCCAATCA;GCCTGTTCACAATGAGCTTGCATTCCAGCCTCCCATTTCCAATCA)
Alt rs771084683(CATTACTG;CATTACTG) rs771084683(GCCTGTTCACAATGAGCTTGCATTCCAGCCTCCCATTTCCAA;GCCTGTTCACAATGAGCTTGCATTCCAGCCTCCCATTTCCAA) rs771084683(GCCTGTTCACAATGAGCTTGCATTCCAGCCTCCCATTTCCAATCA;GCCTGTTCACAATGAGCTTGCATTCCAGCCTCCCATTTCCAATCA)
Reference Rs771084683(-;-)
Significance Pathogenic
Disease Hereditary cancer-predisposing syndrome
Variation info
Gene SMAD4
CLNDBN Hereditary cancer-predisposing syndrome
Reversed 0
HGVS NC_000018.9:g.48584820_48584827dupCATTACTG
CLNSRC
CLNACC RCV000164780.1,