Have questions? Visit https://www.reddit.com/r/SNPedia

rs768265778

From SNPedia

Orientationplus
Stabilizedplus
Geno Mag Summary
(CTACTCATGGTGAGGGAGCT;CTACTCATGGTGAGGGAGCT) 0 common in clinvar
Make rs768265778(-;-)
Make rs768265778(-;CTACTCATGGTGAGGGAGCT)
ReferenceGRCh38.p2 38.2/147
Chromosome17
Position65558613
is asnp
is mentioned by
dbSNPrs768265778
dbSNP (old)rs768265778
ClinGenrs768265778
ebirs768265778
HLIrs768265778
Exacrs768265778
Gnomadrs768265778
Varsomers768265778
Maprs768265778
PheGenIrs768265778
Biobankrs768265778
1000 genomesrs768265778
hgdprs768265778
ensemblrs768265778
gopubmedrs768265778
geneviewrs768265778
scholarrs768265778
googlers768265778
pharmgkbrs768265778
gwascentralrs768265778
openSNPrs768265778
23andMers768265778
23andMe allrs768265778
SNP Nexus

SNPshotrs768265778
SNPdbers768265778
MSV3drs768265778
GWAS Ctlgrs768265778
Max Magnitude0
Mentioned as a pathogenic/likely pathogenic mutation associated with cancer predisposition in [PMID 26681312OA-icon.png]
ClinVar
Risk rs768265778(-;-)
Alt rs768265778(-;-)
Reference Rs768265778(CTACTCATGGTGAGGGAGCT;CTACTCATGGTGAGGGAGCT)
Significance Unknown
Disease Oligodontia-colorectal cancer syndrome
Variation info
Gene
CLNDBN Oligodontia-colorectal cancer syndrome
Reversed 0
HGVS NC_000017.10:g.63554731_63554750del20
CLNSRC
CLNACC RCV000228766.1,