Have questions? Visit https://www.reddit.com/r/SNPedia

rs76675173

From SNPedia

Orientationplus
Stabilizedplus
Geno Mag Summary
(CTGGCCCACCAGGGTGTGCGGC;CTGGCCCACCAGGGTGTGCGGC) 0 common in clinvar
(GCTGGCCCACCAGGGTGTGCGGCC;GCTGGCCCACCAGGGTGTGCGGCC) 0 common in clinvar
Make rs76675173(-;-)
Make rs76675173(-;CTGGCCCACCAGGGTGTGCGGC)
ReferenceGRCh38 38.1/141
Chromosome10
Position100749832
GenePAX2
is asnp
is mentioned by
dbSNPrs76675173
dbSNP (old)rs76675173
ClinGenrs76675173
ebirs76675173
HLIrs76675173
Exacrs76675173
Varsomers76675173
Maprs76675173
PheGenIrs76675173
Biobankrs76675173
1000 genomesrs76675173
hgdprs76675173
ensemblrs76675173
gopubmedrs76675173
geneviewrs76675173
scholarrs76675173
googlers76675173
pharmgkbrs76675173
gwascentralrs76675173
openSNPrs76675173
23andMers76675173
23andMe allrs76675173
SNP Nexus

SNPshotrs76675173
SNPdbers76675173
MSV3drs76675173
GWAS Ctlgrs76675173
Max Magnitude0
OMIM167409
Desc
Variant0003
Relatedalso
ClinVar
Risk rs76675173(-;-)
Alt rs76675173(-;-)
Reference Rs76675173(CTGGCCCACCAGGGTGTGCGGC;CTGGCCCACCAGGGTGTGCGGC)
Significance Pathogenic
Disease Renal coloboma syndrome
Variation info
Gene PAX2
CLNDBN Renal coloboma syndrome
Reversed 0
HGVS NC_000010.10:g.102509589_102509610del22
CLNSRC OMIM Allelic Variant
CLNACC RCV000014808.21,