Have questions? Visit https://www.reddit.com/r/SNPedia

rs730880278

From SNPedia

ClinVar
Risk Rs730880278(CGGCCCGGGCGTCCGGGACGCCGATGAGGAGACACTCCAAGAGAGCC;CGGCCCGGGCGTCCGGGACGCCGATGAGGAGACACTCCAAGAGAGCC) rs730880278(-;-)
Alt Rs730880278(CGGCCCGGGCGTCCGGGACGCCGATGAGGAGACACTCCAAGAGAGCC;CGGCCCGGGCGTCCGGGACGCCGATGAGGAGACACTCCAAGAGAGCC) rs730880278(-;-)
Reference rs730880278(CCCGGCCCGGGCGTCCGGGACGCCGATGAGGAGACACTCCAAGAGAG;CCCGGCCCGGGCGTCCGGGACGCCGATGAGGAGACACTCCAAGAGAG)
Significance Pathogenic
Disease Fanconi anemia
Variation info
Gene FANCF
CLNDBN Fanconi anemia, complementation group F
Reversed 1
HGVS NC_000011.9:g.22646962_22647008del47
CLNSRC OMIM Allelic Variant
CLNACC RCV000006713.5,