Have questions? Visit https://www.reddit.com/r/SNPedia

rs730880277

From SNPedia

Orientationminus
Stabilizedminus
Geno Mag Summary
(TTCCGGGATTAGCGAACTTCCAG;TTCCGGGATTAGCGAACTTCCAG) 0 common in clinvar
Make rs730880277(-;-)
Make rs730880277(-;TTCCGGGATTAGCGAACTTCCAG)
ReferenceGRCh38.p2 38.2/144
Chromosome11
Position22625559
GeneFANCF, GAS2
is asnp
is mentioned by
dbSNPrs730880277
dbSNP (old)rs730880277
ClinGenrs730880277
ebirs730880277
HLIrs730880277
Exacrs730880277
Gnomadrs730880277
Varsomers730880277
Maprs730880277
PheGenIrs730880277
Biobankrs730880277
1000 genomesrs730880277
hgdprs730880277
ensemblrs730880277
gopubmedrs730880277
geneviewrs730880277
scholarrs730880277
googlers730880277
pharmgkbrs730880277
gwascentralrs730880277
openSNPrs730880277
23andMers730880277
23andMe allrs730880277
SNP Nexus

SNPshotrs730880277
SNPdbers730880277
MSV3drs730880277
GWAS Ctlgrs730880277
Max Magnitude0
ClinVar
Risk rs730880277(-;-)
Alt rs730880277(-;-)
Reference Rs730880277(TTCCGGGATTAGCGAACTTCCAG;TTCCGGGATTAGCGAACTTCCAG)
Significance Pathogenic
Disease Fanconi anemia Fanconi anemia
Variation info
Gene FANCF
CLNDBN Fanconi anemia, complementation group F Fanconi anemia
Reversed 1
HGVS NC_000011.9:g.22647105_22647127del23
CLNSRC OMIM Allelic Variant
CLNACC RCV000006712.3, RCV000472440.1,