Have questions? Visit https://www.reddit.com/r/SNPedia

rs727504825

From SNPedia

Orientationminus
Stabilizedminus
Geno Mag Summary
(TGTTGGTGAACCAGTTCAGG;TGTTGGTGAACCAGTTCAGG) 0 common in clinvar
Make rs727504825(-;-)
Make rs727504825(-;TGTTGGTGAACCAGTTCAGG)
ReferenceGRCh38.p2 38.2/144
Chromosome2
Position178614082
GeneTTN, TTN-AS1
is asnp
is mentioned by
dbSNPrs727504825
dbSNP (old)rs727504825
ClinGenrs727504825
ebirs727504825
HLIrs727504825
Exacrs727504825
Gnomadrs727504825
Varsomers727504825
Maprs727504825
PheGenIrs727504825
Biobankrs727504825
1000 genomesrs727504825
hgdprs727504825
ensemblrs727504825
gopubmedrs727504825
geneviewrs727504825
scholarrs727504825
googlers727504825
pharmgkbrs727504825
gwascentralrs727504825
openSNPrs727504825
23andMers727504825
23andMe allrs727504825
SNP Nexus

SNPshotrs727504825
SNPdbers727504825
MSV3drs727504825
GWAS Ctlgrs727504825
Max Magnitude0
ClinVar
Risk rs727504825(-;-)
Alt rs727504825(-;-)
Reference Rs727504825(TGTTGGTGAACCAGTTCAGG;TGTTGGTGAACCAGTTCAGG)
Significance Probable-Pathogenic
Disease Primary dilated cardiomyopathy
Variation info
Gene TTN TTN-AS1
CLNDBN Primary dilated cardiomyopathy
Reversed 1
HGVS NC_000002.11:g.179478809_179478828del20
CLNSRC
CLNACC RCV000156164.1,