Have questions? Visit https://www.reddit.com/r/SNPedia

rs727504339

From SNPedia

Orientationplus
Stabilizedplus
Geno Mag Summary
(ATTAAGAGAAGCAACATCTC;ATTAAGAGAAGCAACATCTC) 0 common in clinvar
(TTAAGAGAAGCAACATCTC;TTAAGAGAAGCAACATCTC) 0 common in clinvar
Make rs727504339(A;A)
Make rs727504339(A;TTAAGAGAAGCAACATCTC)
ReferenceGRCh38.p2 38.2/144
Chromosome7
Position55174776
GeneEGFR
is asnp
is mentioned by
dbSNPrs727504339
dbSNP (old)rs727504339
ClinGenrs727504339
ebirs727504339
HLIrs727504339
Exacrs727504339
Gnomadrs727504339
Varsomers727504339
Maprs727504339
PheGenIrs727504339
Biobankrs727504339
1000 genomesrs727504339
hgdprs727504339
ensemblrs727504339
gopubmedrs727504339
geneviewrs727504339
scholarrs727504339
googlers727504339
pharmgkbrs727504339
gwascentralrs727504339
openSNPrs727504339
23andMers727504339
23andMe allrs727504339
SNP Nexus

SNPshotrs727504339
SNPdbers727504339
MSV3drs727504339
GWAS Ctlgrs727504339
Max Magnitude0
ClinVar
Risk rs727504339(A;A) rs727504339(CAAT;CAAT)
Alt rs727504339(A;A) rs727504339(CAAT;CAAT)
Reference Rs727504339(TTAAGAGAAGCAACATCTC;TTAAGAGAAGCAACATCTC)
Significance Drug-response
Disease Tyrosine kinase inhibitor response
Variation info
Gene EGFR
CLNDBN Tyrosine kinase inhibitor response
Reversed 0
HGVS NC_000007.13:g.55242469_55242487delinsA; NC_000007.13:g.55242469_55242487delinsCAAT
CLNSRC
CLNACC RCV000154456.1, RCV000154485.1,