Have questions? Visit https://www.reddit.com/r/SNPedia

rs727504282

From SNPedia

Orientationplus
Stabilizedplus
Geno Mag Summary
(AATTAAGAGAAGCAACATCTC;AATTAAGAGAAGCAACATCTC) 0 common in clinvar
Make rs727504282(AATTAAGAGAAGCAACATCTC;TCT)
Make rs727504282(TCT;TCT)
ReferenceGRCh38.p2 38.2/144
Chromosome7
Position55174774
GeneEGFR
is asnp
is mentioned by
dbSNPrs727504282
dbSNP (old)rs727504282
ClinGenrs727504282
ebirs727504282
HLIrs727504282
Exacrs727504282
Gnomadrs727504282
Varsomers727504282
Maprs727504282
PheGenIrs727504282
Biobankrs727504282
1000 genomesrs727504282
hgdprs727504282
ensemblrs727504282
gopubmedrs727504282
geneviewrs727504282
scholarrs727504282
googlers727504282
pharmgkbrs727504282
gwascentralrs727504282
openSNPrs727504282
23andMers727504282
23andMe allrs727504282
SNP Nexus

SNPshotrs727504282
SNPdbers727504282
MSV3drs727504282
GWAS Ctlgrs727504282
Max Magnitude0
ClinVar
Risk rs727504282(TCT;TCT)
Alt rs727504282(TCT;TCT)
Reference Rs727504282(AATTAAGAGAAGCAACATCTC;AATTAAGAGAAGCAACATCTC)
Significance Drug-response
Disease Tyrosine kinase inhibitor response
Variation info
Gene EGFR
CLNDBN Tyrosine kinase inhibitor response
Reversed 0
HGVS NC_000007.13:g.55242467_55242487delinsTCT
CLNSRC
CLNACC RCV000154290.1,