Have questions? Visit https://www.reddit.com/r/SNPedia

rs727504120

From SNPedia

ClinVar
Risk
Alt
Reference Rs727504120(GCCGCCGCGGAACCCCCGGCACCGCC;GCCGCCGCGGAACCCCCGGCACCGCC)
Significance Pathogenic
Disease not provided Retinoblastoma
Variation info
Gene LINC00441 RB1
CLNDBN not provided Retinoblastoma
Reversed 0
HGVS NC_000013.10:g.48878102_48878127delGGAACCCCCGGCACCGCCGCCGCCGC
CLNSRC
CLNACC RCV000153807.2, RCV000173107.1,