Have questions? Visit https://www.reddit.com/r/SNPedia

rs63749064

From SNPedia

Orientationminus
Stabilizedminus
Geno Mag Summary
(GCTCACTGGAGAGCGACGGCTGCCC;GCTCACTGGAGAGCGACGGCTGCCC) 0 common in clinvar
Make rs63749064(AGCGGCCG;AGCGGCCG)
Make rs63749064(AGCGGCCG;GCTCACTGGAGAGCGACGGCTGCCC)
ReferenceGRCh38.p2 38.2/144
ChromosomeX
Position154030539
GeneMECP2
is asnp
is mentioned by
dbSNPrs63749064
dbSNP (old)rs63749064
ClinGenrs63749064
ebirs63749064
HLIrs63749064
Exacrs63749064
Gnomadrs63749064
Varsomers63749064
Maprs63749064
PheGenIrs63749064
Biobankrs63749064
1000 genomesrs63749064
hgdprs63749064
ensemblrs63749064
gopubmedrs63749064
geneviewrs63749064
scholarrs63749064
googlers63749064
pharmgkbrs63749064
gwascentralrs63749064
openSNPrs63749064
23andMers63749064
23andMe allrs63749064
SNP Nexus

SNPshotrs63749064
SNPdbers63749064
MSV3drs63749064
GWAS Ctlgrs63749064
Max Magnitude0
ClinVar
Risk rs63749064(AGCGGCCG;AGCGGCCG)
Alt rs63749064(AGCGGCCG;AGCGGCCG)
Reference Rs63749064(GCTCACTGGAGAGCGACGGCTGCCC;GCTCACTGGAGAGCGACGGCTGCCC)
Significance Pathogenic
Disease Rett syndrome
Variation info
Gene MECP2
CLNDBN Rett syndrome
Reversed 1
HGVS NC_000023.10:g.153295990_153296014del25insCGGCCGCT
CLNSRC
CLNACC RCV000132978.2,