Have questions? Visit https://www.reddit.com/r/SNPedia

rs63749029

From SNPedia

Orientationminus
Stabilizedminus
Geno Mag Summary
(GCCCCCACCTCCACCTGAGCCCGAGAGCT;GCCCCCACCTCCACCTGAGCCCGAGAGCT) 0 common in clinvar
Make rs63749029(-;-)
Make rs63749029(-;GCCCCCACCTCCACCTGAGCCCGAGAGCT)
ReferenceGRCh38.p2 38.2/144
ChromosomeX
Position154030642
GeneMECP2
is asnp
is mentioned by
dbSNPrs63749029
dbSNP (old)rs63749029
ClinGenrs63749029
ebirs63749029
HLIrs63749029
Exacrs63749029
Gnomadrs63749029
Varsomers63749029
Maprs63749029
PheGenIrs63749029
Biobankrs63749029
1000 genomesrs63749029
hgdprs63749029
ensemblrs63749029
gopubmedrs63749029
geneviewrs63749029
scholarrs63749029
googlers63749029
pharmgkbrs63749029
gwascentralrs63749029
openSNPrs63749029
23andMers63749029
23andMe allrs63749029
SNP Nexus

SNPshotrs63749029
SNPdbers63749029
MSV3drs63749029
GWAS Ctlgrs63749029
Max Magnitude0
ClinVar
Risk rs63749029(-;-)
Alt rs63749029(-;-)
Reference Rs63749029(GCCCCCACCTCCACCTGAGCCCGAGAGCT;GCCCCCACCTCCACCTGAGCCCGAGAGCT)
Significance Pathogenic
Disease Rett syndrome
Variation info
Gene MECP2
CLNDBN Rett syndrome
Reversed 1
HGVS NC_000023.10:g.153296093_153296121del29
CLNSRC
CLNACC RCV000132899.2,